The Asp1822Val variant of the APC gene is a common polymorphism without clinical implications.

Editor–Germline mutations of the adenomatous polyposis coli (APC) tumour suppressor gene result in the hereditary colorectal cancer syndrome familial adenomatous polyposis (FAP). Almost all APC mutations that have been identified are single nucleotide alterations, small insertions, or deletions that would cause a truncated APC protein. Mutations causing amino acid changes in the APC protein have also been reported, but the association of these APC variants with the FAP phenotype is sometimes unclear. In a recent issue of this journal, a homozygous single base substitution involving an A to T transversion at codon 1822 of the APC gene was reported as probably pathological in one FAP patient and two non-FAP patients. This double substitution causes an amino acid change (aspartic acid to valine) in the middle of the â-catenin down regulation domain of the APC protein and was the only genetic alteration found in the three aforementioned patients. A whole APC allele deletion was not proven in the samples, but dismissed by the authors as the patients did not exhibit the classical FAP phenotype that would be expected in patients with whole deletions. In an assay carried out on 45 normal subjects, Wallis et al did not observe any homozygous changes at codon 1822. We have found the heterozygous genotype Asp1822Val in the aVected members of four FAP families out of 17 analysed in Spain and the homozygous nucleotide substitution was found in one of them. Surprisingly, the aVected members of one of these five families carried another germline mutation in the APC gene (Ser2621Cys). These observations suggest that the common Asp1822Val alteration could be a lower penetrant allele that increases the risk of developing colorectal cancer. To assess the risk of this APC allelic variant in colorectal carcinogenesis, we screened 158 chromosomes from a random white population from north western Spain and provide evidence against a disease causing eVect of the Asp1822Val variant. DNA was extracted from peripheral blood leucocytes of 79 healthy, unrelated subjects from Galicia (north western Spain), having first obtained informed consent for its use in research. The identification of the Asp1822Val missense variant was carried out by real time fluorescent PCR in the LightCycler (Roche Molecular Biochemicals). This instrument is designed for mutation detection by melting point analysis with fluorescent hybridisation probes using the fluorescence energy transfer (FRET) principle. 5 A 280 bp fragment including codon 1822 of the APC gene was amplified by real time fluorescent PCR using the forward primer 5' GTCGTCTTCT GCACCCAACAA and the reverse primer 5' AGGCGTGTAATGATGAGGTGAATC. The probes hybridise to the codon 1822 site internal to the APC primer pair. The sequence of the sensor fluorescein labelled probe was 5' TAATTCCAAGGACTTCAATGATAAGC and that of the anchor LC-Red 640 labelled probe was 5' CCCAAATAATGAAGATA GAGTCAGAGGAAG (Tib MolBiol). The adjacent probes emit fluorescence only while they are hybridised to their complementary strand. Amplification was performed using the LightCycler DNA Master Hybridization Probes kit (Roche Molecular Biochemicals) in a standard PCR containing 0.5 μmol/l of each primer and 0.1 μmol/l of each probe in a 20 μl final volume with 2 μl of sample. A negative control without DNA sample was included in all assays. The reaction mixture was denatured at 95°C for two minutes, followed by 35 cycles of denaturation (95°C for 0 seconds, ramp rate 20°C/second), annealing (58°C for 10 seconds, ramp rate 20oC/second), and extension (72°C, five seconds, ramp rate 20°C/second). After amplification of the APC gene fragment, the melting curve was determined by holding the reaction at 50°C for 10 seconds and then heating slowly to 94°C with a linear rate of 0.2°C/ second while the fluorescence emitted was measured. Plotting fluorescence (F) versus temperature (T) generated melting curves. Discriminated melting peaks were produced by the LightCycler software. We have genotyped codon 1822 of the APC gene in 158 chromosomes from a healthy random population. We have studied the mutation site (A to T) that corresponds to the second JMG 2001;38:e33 (http://www.jmgjnl.com/cgi/content/full/38/10/e33) 1 of 3